View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_82 (Length: 249)
Name: NF1739_low_82
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1739_low_82 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 21061959 - 21061729
Alignment:
| Q |
20 |
ttgtgtctattttttg-tataagactgttttggttatgcatattaattagacaaagcatattaaatatatgatgctcttgaaaaacttcttctactttat |
118 |
Q |
| |
|
|||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21061959 |
ttgtttctattttttggtataagaccgttttggttatgcatattaattagacaaagcatattaaatatatgatgctcttgaaaaacttcttctactttat |
21061860 |
T |
 |
| Q |
119 |
taaaaaataattttgttgagacaacttcgaacaacaacaaatttaggtatgagaggggtggtc-tggggagtaatcaaagagccttcctgtgggtgatgt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21061859 |
taaaaaataattttgttgagacaacttcgaacaacaacaaatttaggtatgagaggggtggtcttggggagtaatcaaagagccttcctgtgggtgatgt |
21061760 |
T |
 |
| Q |
218 |
ctggaagtctgggaatcaaggaacatttgtt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21061759 |
ctggaagtctgggaatcaaggaacatttgtt |
21061729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University