View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1739_low_89 (Length: 245)
Name: NF1739_low_89
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF1739_low_89 |
| |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 127 - 227
Target Start/End: Complemental strand, 21145378 - 21145278
Alignment:
Q |
127 |
aacaaattggtgcataaagtaaaacacaaattgtatctaccaaagatcagtgacttcctgtctcttattatcttatgtcattaagtatagcacaaaacgt |
226 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
21145378 |
aacaaattggggcataaagtaaaacacaaattgtatctaccaaagatcagtgacttcctgtttcttattatcttatgtcattaagtatagcacaaaacgt |
21145279 |
T |
|
Q |
227 |
g |
227 |
Q |
|
|
| |
|
|
T |
21145278 |
g |
21145278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 40 - 129
Target Start/End: Complemental strand, 21145580 - 21145492
Alignment:
Q |
40 |
agttaagcttcattaactgaattagaagaacttttatatatgaaacgaaatnnnnnnnnttaagtgaaaggggtgtgaaatttacctaac |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||||||||||||| |
|
|
T |
21145580 |
agttaagcttcattaactgaattagaagaacttttatacatgaaacgaaat-aaaaaaattaagtgaaagggaggtgaaatttacctaac |
21145492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1940 times since January 2019
Visitors: 8699