View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1739_low_89 (Length: 245)

Name: NF1739_low_89
Description: NF1739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1739_low_89
NF1739_low_89
[»] chr7 (2 HSPs)
chr7 (127-227)||(21145278-21145378)
chr7 (40-129)||(21145492-21145580)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 127 - 227
Target Start/End: Complemental strand, 21145378 - 21145278
Alignment:
127 aacaaattggtgcataaagtaaaacacaaattgtatctaccaaagatcagtgacttcctgtctcttattatcttatgtcattaagtatagcacaaaacgt 226  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
21145378 aacaaattggggcataaagtaaaacacaaattgtatctaccaaagatcagtgacttcctgtttcttattatcttatgtcattaagtatagcacaaaacgt 21145279  T
227 g 227  Q
    |    
21145278 g 21145278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 40 - 129
Target Start/End: Complemental strand, 21145580 - 21145492
Alignment:
40 agttaagcttcattaactgaattagaagaacttttatatatgaaacgaaatnnnnnnnnttaagtgaaaggggtgtgaaatttacctaac 129  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||        |||||||||||||  ||||||||||||||||    
21145580 agttaagcttcattaactgaattagaagaacttttatacatgaaacgaaat-aaaaaaattaagtgaaagggaggtgaaatttacctaac 21145492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University