View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740-Insertion-3 (Length: 372)
Name: NF1740-Insertion-3
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740-Insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 189 - 371
Target Start/End: Complemental strand, 32266822 - 32266640
Alignment:
| Q |
189 |
tttgtgttgctgctacaacagtgaatctaaggaaatctaagagaagaattaggttcaagtctattactctttcaaatcatcaaccttcttcttcttctgt |
288 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32266822 |
tttgtgttgctgctacaacaatgaatctaaggaaatctaagagaagaattaggttcaagtctattactctttcaaatcagcaaccttcttcttcttctgt |
32266723 |
T |
|
| Q |
289 |
taatggcggttcttcatctgtttctgagatggaacaggaacaacaagaagaggttgctagatgtttgatgttgttgtctagag |
371 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32266722 |
taatggtggttcttcatctgtttctgagatggaacaggaacaacaagaagaggttgctagatgtttgatgttgttgtctagag |
32266640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 8 - 162
Target Start/End: Complemental strand, 32267006 - 32266852
Alignment:
| Q |
8 |
gctgcaaccacattggaacaaaatgaaatgatcaaattctgcaaagaatgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267006 |
gctgcaaccacattggaacaaaatgaaatgatcaaattctgcaaagaatgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctc |
32266907 |
T |
|
| Q |
108 |
attctgagaaagagaaaaagatcaacaaggctatgatggaggaggatactcaatc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32266906 |
attctgagaaagagaaaaagatcaacaaggctatgatggaggaggatactcaatc |
32266852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 41 - 120
Target Start/End: Complemental strand, 19301476 - 19301397
Alignment:
| Q |
41 |
aaattctgcaaagaatgtgggaaaggttttccttcattgaaagcactttgtggacacatggcttctcattctgagaaaga |
120 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||| ||||| |||||||||| ||| ||||||||||| |
|
|
| T |
19301476 |
aaattctgcaaagaatgtggaaaaggttttccatcattgaaagcactgtgtggtcacatggcttgtcactctgagaaaga |
19301397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University