View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17400_low_7 (Length: 275)

Name: NF17400_low_7
Description: NF17400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17400_low_7
NF17400_low_7
[»] chr3 (1 HSPs)
chr3 (16-257)||(44998411-44998652)


Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 257
Target Start/End: Original strand, 44998411 - 44998652
Alignment:
16 aggcggtgggaagcggaggagggagtacttgggaggtagctgtggtggaggagaggagaaagaggcagcaaataaggaggagaaggatgaagatgaaggg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44998411 aggcggtgggaagcggaggagggagtacttgggaggtagctgtggtggaggagaggagaaagaggcagcaaataaggaggagaaggatgaagatgaaggg 44998510  T
116 aaatggtgatcatggtgagaatgaagaaggagacgaggaggaagaagataacatcagtggtggcggtgagagacaaagagaacatccattcattgtgaca 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44998511 aaatggtgatcatggtgagaatgaagaaggagacgaggaggaagaagataacatcagtggtggcggtgagagacaaagagaacatccattcattgtgaca 44998610  T
216 gagcctggggaagttgcacgtggcaaaaagaacggtctagat 257  Q
    ||||||||||||||||||||||||||||||||||||||||||    
44998611 gagcctggggaagttgcacgtggcaaaaagaacggtctagat 44998652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University