View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17401_low_14 (Length: 293)
Name: NF17401_low_14
Description: NF17401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17401_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 292
Target Start/End: Complemental strand, 39631687 - 39631407
Alignment:
| Q |
13 |
cacagaatattatgccactagaaatattnnnnnnnntaacaatttgtttgaatgagctttaacatttcggggagattaagatgccacgtacgtttaatca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39631687 |
cacagaatattatgccactagaaatattaaaaaaaataacaatttgtttgaatgagctttaacatttcggggagattaagatgccacgtacgtttaatca |
39631588 |
T |
 |
| Q |
113 |
ataaacaaaagatgatcagccatcagta-tttaatcaattatagtattaagattagttgtacataccttaagttatgagttaaacaagtttcaaaggcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39631587 |
ataaacaaaagatgatcagccatcagtaatttaatcaattatagtattaagattagttgtacataccttaagttatgagttaaacaagtttcaaaggcat |
39631488 |
T |
 |
| Q |
212 |
atattgtcaaggttttggaaatcttttgctccctttttaattctgaataagtcagaaagatttgcgtggtatcataattca |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
39631487 |
atattgtcaaggttttggaaatcttttgctccctttttaattctgaataagtcagaaagatttgagtggtatcataattca |
39631407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University