View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17401_low_16 (Length: 280)
Name: NF17401_low_16
Description: NF17401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17401_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 7 - 262
Target Start/End: Original strand, 33120591 - 33120847
Alignment:
| Q |
7 |
taatgactaaagatgagtatattcacgtaatcgaccaacttgttatcaactcnnnnnnnn-ataagtttttcttccccatgtttcgctttgttatttctc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
33120591 |
taatgactaaagatgagtatattcacgtaatcgaccaacttgttatcaactctttttttttataggtttttcttccccatgtttcactttgttatttctc |
33120690 |
T |
 |
| Q |
106 |
ctcgatgactcaacatatggttcttctccttattcaaatttcttgacttccacaatgttgagtttctctttgtaccttatgtcggttttagctttgttta |
205 |
Q |
| |
|
||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33120691 |
ctccatgactcaacatatgattcttctccttattcaaatttcttgacttccacaatgttgagtttctctttgtaccttatgtcggttttagctttgttta |
33120790 |
T |
 |
| Q |
206 |
aggagtcgttgagatttcttggctcttcgactttgatggctttattgacgttgattc |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33120791 |
aggagtcgttgagatttcttggctcttcgactttgatggccttattgacgttgattc |
33120847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University