View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17401_low_17 (Length: 259)
Name: NF17401_low_17
Description: NF17401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17401_low_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 259
Target Start/End: Original strand, 33119873 - 33120113
Alignment:
| Q |
17 |
tatttatcatggtctttatcgagcggcaaagagtgagatgtaaaaattggatagatagtgtggtgtgtgaatgaaggggactcattataggattggtttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33119873 |
tatttatcatggtctttatcgagcggcaaagagtgagatgtaaaaattggatagatagtgtggtgt--gaatgaaggggactcattataggattggtttc |
33119970 |
T |
 |
| Q |
117 |
gatgtcgttggtcatttgaatgaaggtcattacaaagtgccgtgccataaacgttaagttctgtttgttatgtgtcgttgagacgttacagagtgaacga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33119971 |
gatgtcgttggtcatttgaatgaaggtcattacaaagtgccgtgccatcaacatcaagttctgtttgttatgtgtcgttgagacattacagagtgaacga |
33120070 |
T |
 |
| Q |
217 |
tatttggttagccgttggaagcatttgaggagcagcacagacc |
259 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33120071 |
tatttggctagccgttggaagcatttgaggagcaggacagacc |
33120113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University