View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17402_high_23 (Length: 357)
Name: NF17402_high_23
Description: NF17402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17402_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 297; Significance: 1e-167; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 28 - 324
Target Start/End: Complemental strand, 29606751 - 29606455
Alignment:
| Q |
28 |
caggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggatggggtttttgggcttaatgccgg |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606751 |
caggtggtatagataatggtggtagagaaacaggtgcttttttgggtggatgtggtggtggttgaattttaggggatggggtttttgggcttaatgccgg |
29606652 |
T |
|
| Q |
128 |
tgtaacctttgggactggcaactttacaggagcgagttttggaggatccggaactggtgatttgacaggagcagttgttggaggttttgattttggaact |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606651 |
tgtaacctttgggactggcaactttacaggagcgagttttggaggatccggaactggtgatttgacaggagcagttgttggaggttttgattttggaact |
29606552 |
T |
|
| Q |
228 |
ggtggtttcacaggagaaggttttggtgcgggagctttcggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaactattggtt |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29606551 |
ggtggtttcacaggagaaggttttggtgcgggagctttcggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaactattggtt |
29606455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 267 - 317
Target Start/End: Complemental strand, 29606377 - 29606327
Alignment:
| Q |
267 |
ggaactggtggtttcaaaggagcagatgttggagttgtagtttttggaact |
317 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| |||| |||||||||| |
|
|
| T |
29606377 |
ggaactggcggtttcacaggagcagatgttggagtcgtagcttttggaact |
29606327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University