View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17402_high_42 (Length: 309)
Name: NF17402_high_42
Description: NF17402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17402_high_42 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 10 - 309
Target Start/End: Original strand, 8073259 - 8073551
Alignment:
| Q |
10 |
attattctaatatcgcagtttttaatcattgtaggtgtactagctaatatatattactactgactaaataatcaaactcagttaatgagtcttagctaat |
109 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
8073259 |
attattctaatattgcagtttttaatc-------gtgtactagctaatatatattactactgactaaataatcaaacttagttaatgagttttagctaat |
8073351 |
T |
 |
| Q |
110 |
gacaaatcctttgagagatttggattcaaagttttgctagaattatttttagtcaaattttacttatcttgcggtcgaggtctaaattaccacgacacgt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| | |
|
|
| T |
8073352 |
gacaaatcctttgagagatttggattcaaaattttgctagaattatttttagtcaaattttacttatcttacggtcgaggtctaaattaccatgacactt |
8073451 |
T |
 |
| Q |
210 |
ttgaatgtctcattcacctacttgcctactccataggagttcatatctcctcttttcttgcacttccatcttccctttataccatcttaatggaatatct |
309 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8073452 |
ttgaatgtctcattcacctacttgcccactccataggagttcatatctcctcttttcttgcacttccatcttccctttataccatcttaatggaatatct |
8073551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University