View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17402_high_43 (Length: 306)
Name: NF17402_high_43
Description: NF17402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17402_high_43 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 92; Significance: 1e-44; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 123 - 226
Target Start/End: Complemental strand, 31788613 - 31788511
Alignment:
| Q |
123 |
acttcacgttattttttgcttgtgaagaagaaattataacaatgtctcaatatcaacaaggttatggtgatcaaacacgtagggttgatgaatatggaaa |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31788613 |
acttcacgttattttttgtttgtgaagaagaa-ttataacaatgtctcaatatcaacaaggttatggtgatcaaacacgtagggttgatgaatatggaaa |
31788515 |
T |
|
| Q |
223 |
ccca |
226 |
Q |
| |
|
|||| |
|
|
| T |
31788514 |
ccca |
31788511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 239 - 289
Target Start/End: Original strand, 31788381 - 31788431
Alignment:
| Q |
239 |
aacctgtggtttgatcaactcaaactccatgatgttgttgatgatgtccat |
289 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31788381 |
aacctgtggtttgatcaactccaactccatgatgttgttgatgatgtccat |
31788431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University