View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17404_high_7 (Length: 268)
Name: NF17404_high_7
Description: NF17404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17404_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 21 - 252
Target Start/End: Complemental strand, 28594524 - 28594296
Alignment:
| Q |
21 |
ctaacaacttagttgggatgtctaagttctctcttgatgtttgtcctttctcctagcttattagaagnnnnnnnnnnnngaatttaaggataacaacata |
120 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||| ||| ||||||||||||| ||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
28594524 |
ctaacaacttagttgagatgtctgagttttctcttaatgcttgtcctttctccaagcttattagaagaaaaaaaa----gaatttaaggataaccacata |
28594429 |
T |
 |
| Q |
121 |
aataaaatggataaaatctagcacctcgatcttgacnnnnnnnnnnnnnnnnnn-ctaagtgatgtcagtaacaatgtcatttctatcgtatactaattt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28594428 |
aataaaatggataaaatctagcacctcgatcttgacttttttttttcttttttttctaagtgatgtcagtaacaatgtcatttctatcgtatactaattt |
28594329 |
T |
 |
| Q |
220 |
gcttatagctactgacttcatatagatcatatt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28594328 |
gcttatagctactgacttcatatagatcatatt |
28594296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 25 - 81
Target Start/End: Original strand, 26916665 - 26916721
Alignment:
| Q |
25 |
caacttagttgggatgtctaagttctctcttgatgtttgtcctttctcctagcttat |
81 |
Q |
| |
|
|||| ||||||||||||| | | | |||| |||||||||||||||||||| |||||| |
|
|
| T |
26916665 |
caacctagttgggatgtcgacgatgtctcctgatgtttgtcctttctccttgcttat |
26916721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University