View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17404_low_11 (Length: 249)
Name: NF17404_low_11
Description: NF17404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17404_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 7291669 - 7291925
Alignment:
| Q |
1 |
ttatgagaatatgattctccatgaattgaggatcaataattaattccacaacttgcaaacgcacctta------------------cttaaactctagat |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7291669 |
ttatgagaatatgattctccatgaattgaggatcaataattaattccacaacttgcaaacgcaccttaactcagtggattgcttgacttaaactctagat |
7291768 |
T |
|
| Q |
83 |
aggatttcgatcatcagttcctctagtagaaccgtgcacagcgactctgtagttgcttcccccatcatgcaacaacgattacgcgtcatcacggcatggt |
182 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7291769 |
aggatttcgatcatcagttcctctggtagaaccgtgcacagcgactctgtagttgcttccgccatcatgcaacaacgattacgcgtcatcatggcatggt |
7291868 |
T |
|
| Q |
183 |
tactgtttctcttttccttgttgnnnnnnnncttcttctgtgattttagggtttcat |
239 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
7291869 |
tactgtttctcttttccttgttgttttttttcttcttctgttattttagggtttcat |
7291925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 73 - 151
Target Start/End: Original strand, 7298572 - 7298650
Alignment:
| Q |
73 |
aactctagataggatttcgatcatcagttcctctagtagaaccgtgcacagcgactctgtagttgcttcccccatcatg |
151 |
Q |
| |
|
||||||||| |||||||||||||||||||| | |||||||| ||||| | ||||| | |||||||||| |||||||| |
|
|
| T |
7298572 |
aactctagagaggatttcgatcatcagttcatgcggtagaaccatgcacggtgactcgggagttgcttccgccatcatg |
7298650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 151
Target Start/End: Original strand, 39576989 - 39577057
Alignment:
| Q |
83 |
aggatttcgatcatcagttcctctagtagaaccgtgcacagcgactctgtagttgcttcccccatcatg |
151 |
Q |
| |
|
|||||||||||||||||||| || || ||||||||||| || |||| |||||| ||| | |||||||| |
|
|
| T |
39576989 |
aggatttcgatcatcagttctgctggttgaaccgtgcacggcaactcagtagtttctttcgccatcatg |
39577057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University