View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17404_low_13 (Length: 218)
Name: NF17404_low_13
Description: NF17404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17404_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 15 - 200
Target Start/End: Original strand, 35418693 - 35418884
Alignment:
| Q |
15 |
aatatgcagcaacaaggaaaaggaaaaatatt-catcaattattcaactgtaaggtgtaacatctggaaaagt-cttcacc--taatgaatgcagaaact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||| |
|
|
| T |
35418693 |
aatatgcagcaacaaggaaaaggaaaaatatttcatcaattattcaactgtaaggtgtaacatctggaaaagttcttcaaccttaatgaatgcagaaact |
35418792 |
T |
 |
| Q |
111 |
gcagtaagttccaaaaatatggtgtcaccttaacctaactgctaat--ctatcatagctccatacatgacaagacaaaattggggaaaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35418793 |
gcagtaagttccaaaaatatggtgtcaccttaacctaactgctaatcactatcatagctccatacatgacaagacaaaattggggaaaattt |
35418884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University