View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17406_low_11 (Length: 249)
Name: NF17406_low_11
Description: NF17406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17406_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 6454452 - 6454314
Alignment:
| Q |
1 |
tatttgttattcctttgggttcagaatcagaaatattagaaggaagacttatgtttaaagataggtctggttctaacaaaggtgaaaataaagtatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454452 |
tatttgttattcctttgggttcagaatcagaaatattagaaggaagacttatgtttaaagataggtctggttctaacaaaggtgaaaataaagtatgcat |
6454353 |
T |
 |
| Q |
101 |
tttaggatgtgatttaattagggtatagtatagagtact |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454352 |
tttaggatgtgatttaattagggtatagtatagagtact |
6454314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 199 - 235
Target Start/End: Complemental strand, 6454254 - 6454218
Alignment:
| Q |
199 |
agtgattatatgatcatgagtgagtcatgatttgcat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6454254 |
agtgattatatgatcatgagtgagtcatgatttgcat |
6454218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University