View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17406_low_12 (Length: 244)
Name: NF17406_low_12
Description: NF17406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17406_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 16 - 242
Target Start/End: Complemental strand, 8329077 - 8328852
Alignment:
| Q |
16 |
ctattttcacccataatttcaagtcatgatgggttaaaattaactctcgagttatccgactcattcttaatatacnnnnnnnctaaaaatagcagatact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
8329077 |
ctattttcacccataatttcaagtcatgataggctaaaattaactctcgagttatccgactcatccttaatatacttttttta-aaaaatagcagatact |
8328979 |
T |
 |
| Q |
116 |
ttgaaacggtcctgtaaaagataaaaagttgtttgcgcaagaaaaagtcttatgagacattttatagtacttgtcatgtatttgaaaaaatggttttcct |
215 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8328978 |
ttgaaacggtccggtaaaaaataaaaagttgtttgcgcaagaaaaagtcttatgagacattttatagtacttgtcatgtatttgaaaaaatggttttcct |
8328879 |
T |
 |
| Q |
216 |
cagtactaatccaccagtaaattaggc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8328878 |
cagtactaatccaccagtaaattaggc |
8328852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University