View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17407_high_21 (Length: 253)

Name: NF17407_high_21
Description: NF17407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17407_high_21
NF17407_high_21
[»] chr1 (1 HSPs)
chr1 (40-235)||(37355176-37355371)


Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 40 - 235
Target Start/End: Original strand, 37355176 - 37355371
Alignment:
40 aatttgaggatgatgaaacaatctgtggtggagtaattcagcaggagttggatgtcattttcaagagttttggttggccaatactctatcagatcgggga 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37355176 aatttgaggatgatgaaacaatctgtggtggagtaattcagcaggagttggatgtcattttcaagagttttggttggccaatactctatcagatcgggga 37355275  T
140 cataaaaccacagcatggagcccatggtttggaagcatccagttaaggggatttttgtaatgcagagtatctatctcaattatgttgctcaaatgt 235  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37355276 cataaaaccacagcatggagcccatggtttggaagcatccagttaaggggatttttgtaatgcagagtatctatctcaattatgttgctcaaatgt 37355371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University