View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17407_low_28 (Length: 226)
Name: NF17407_low_28
Description: NF17407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17407_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 208
Target Start/End: Original strand, 40809253 - 40809457
Alignment:
| Q |
5 |
gaggagcagcac-agaaccaatatacttcaaactcgaaagatcatacttatcaaccaaaccatgtttcgctagagcgagtacaatcggtggcacaatcca |
103 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809253 |
gaggagcagcaccagaaccaatatacttcaaactcgaaagatcatacttatcaaccaaaccatgtttcgctagagcgagtacaatcggtggcacaatcca |
40809352 |
T |
 |
| Q |
104 |
taatctcgtaaccctaaacttctcaatcgttttcaaaaccacttcaaactcaaaccgcttcaacgaaacaatcgcattccctctctgaagctgcgaatac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40809353 |
taatctcgtaaccctaaacttctcaatcgttttcaaaaccacttcaaactcaaaccgcttcaacgaaacaatcgcattccctctctgaagctgcgaatac |
40809452 |
T |
 |
| Q |
204 |
gttat |
208 |
Q |
| |
|
||||| |
|
|
| T |
40809453 |
gttat |
40809457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University