View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_high_57 (Length: 255)
Name: NF17408_high_57
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_high_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 10419042 - 10418810
Alignment:
| Q |
1 |
gtgtacgtattcttttgcaacaataaaaaatcacgtgtaatgtttcgcaagctnnnnnnnntagcgttgaatttatagacttatgcattaaaacaaaatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
10419042 |
gtgtacgtattcttttgcaacaataaaaaatcacgtgtaatgtttcgcaagctaaaaaaaatagcgttgaatttatagact-atacattaaaacaaaatt |
10418944 |
T |
 |
| Q |
101 |
aaaaggcattctgacttttgtgttaatatttggtgtattaattggcatcgcaagaaagtcaacccctcctgggatccttatatgccgactcattcggcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || | |||||| |
|
|
| T |
10418943 |
aaaaggcattctgacttttgtgttaatatttggtgtattaattggcatcgcatgaaagtcaacccctcctgggatccttatatgccgattcctccggcac |
10418844 |
T |
 |
| Q |
201 |
taattaatttcaacccattcctcgctgacttctt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10418843 |
taattaatttcaacccattcctcgctgacttctt |
10418810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University