View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17408_high_63 (Length: 246)

Name: NF17408_high_63
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17408_high_63
NF17408_high_63
[»] chr8 (1 HSPs)
chr8 (210-246)||(9370117-9370153)
[»] chr7 (1 HSPs)
chr7 (210-246)||(47817420-47817456)
[»] chr4 (1 HSPs)
chr4 (210-246)||(23669261-23669297)


Alignment Details
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 210 - 246
Target Start/End: Complemental strand, 9370153 - 9370117
Alignment:
210 ggcggtgtctagggtgggagaccttaatagatctcct 246  Q
    |||||||||||||||||||||||||||||| ||||||    
9370153 ggcggtgtctagggtgggagaccttaataggtctcct 9370117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 210 - 246
Target Start/End: Original strand, 47817420 - 47817456
Alignment:
210 ggcggtgtctagggtgggagaccttaatagatctcct 246  Q
    |||||||||||||||||||||||||||||| ||||||    
47817420 ggcggtgtctagggtgggagaccttaataggtctcct 47817456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 210 - 246
Target Start/End: Complemental strand, 23669297 - 23669261
Alignment:
210 ggcggtgtctagggtgggagaccttaatagatctcct 246  Q
    |||||||||||||||||||||||||||||| ||||||    
23669297 ggcggtgtctagggtgggagaccttaataggtctcct 23669261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University