View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_high_63 (Length: 246)
Name: NF17408_high_63
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_high_63 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 210 - 246
Target Start/End: Complemental strand, 9370153 - 9370117
Alignment:
| Q |
210 |
ggcggtgtctagggtgggagaccttaatagatctcct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9370153 |
ggcggtgtctagggtgggagaccttaataggtctcct |
9370117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 210 - 246
Target Start/End: Original strand, 47817420 - 47817456
Alignment:
| Q |
210 |
ggcggtgtctagggtgggagaccttaatagatctcct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47817420 |
ggcggtgtctagggtgggagaccttaataggtctcct |
47817456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 210 - 246
Target Start/End: Complemental strand, 23669297 - 23669261
Alignment:
| Q |
210 |
ggcggtgtctagggtgggagaccttaatagatctcct |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23669297 |
ggcggtgtctagggtgggagaccttaataggtctcct |
23669261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University