View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_high_64 (Length: 245)
Name: NF17408_high_64
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_high_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 4317487 - 4317696
Alignment:
| Q |
1 |
gctagttcaagcttttgttccatgatttgccggcttcccctttagtccattacaagctgtgtcagttctcttctggcatacagcactgctcaatttaata |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4317487 |
gctagtttaagcttttgttccatgatttgccggcttcccctttagtccattacaagctgtgttagttctcttctggcatacagcactgctcaatttaata |
4317586 |
T |
 |
| Q |
101 |
cagtagtatagtcgactcggacttgatttcagctatggtaaagcttggttggttggtactggtagttacagaatcagtgccattaatagtgttgatgtaa |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4317587 |
cagtagtataatcgactcggacttgatttcagctatggtaaagcttggttggttggtactggtaggtacagaatcagtgccattaatagtgttgatgtaa |
4317686 |
T |
 |
| Q |
201 |
accaagactg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
4317687 |
accaagactg |
4317696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University