View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_high_81 (Length: 217)
Name: NF17408_high_81
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_high_81 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 217
Target Start/End: Original strand, 46816315 - 46816521
Alignment:
| Q |
11 |
cacagaatctagtaatatttgagagcaacaaatcccagtgcaatcaatagaacagtaggtgagacattgtaagatgtaatggcagatgatggagtcagag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
46816315 |
cacagaatctagtaatatttgagagcaacaaatcccagtgcaatcaatagaacagtaggtgagacattgtaagatgtaatggcagatgatggagtcaaag |
46816414 |
T |
 |
| Q |
111 |
atgagcggccacttcccgttgttgacaccgatggcgatggcggagtcaaaagaggaacatttgtgtcttgttgtggtgccagaggagatgaagttggtga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46816415 |
atgagcggccacttcccgttgttgacaccgatggcgatggcggagtcaaaagaggaacatttgtgtcttgttgtggtgccagaggagatgaagttggtga |
46816514 |
T |
 |
| Q |
211 |
agctggt |
217 |
Q |
| |
|
||||||| |
|
|
| T |
46816515 |
agctggt |
46816521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University