View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_high_82 (Length: 216)
Name: NF17408_high_82
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_high_82 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 108 - 216
Target Start/End: Complemental strand, 46213526 - 46213418
Alignment:
| Q |
108 |
caagcttcttcagctttcctggaagcaaatttgaaatcgctagagcggagaccttgttgttgaagaacatcttcaacgacagaaacaacagagaatggtg |
207 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46213526 |
caagcttcttcggctttcctggaagcaaatttgaaatcgctagagcggagaccttgttgttgaagaacatcttcaacgacagaaacaacagagaatggtg |
46213427 |
T |
 |
| Q |
208 |
aaacttgat |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
46213426 |
aaacttgat |
46213418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University