View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_high_85 (Length: 208)
Name: NF17408_high_85
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_high_85 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 95 - 196
Target Start/End: Complemental strand, 27923979 - 27923879
Alignment:
| Q |
95 |
tttgatgacttatggtgaacctccaaccgaattagaccgtataagcatttctatatgtaaagtcattaaaaattgtgtatgtattaatatgttttctcat |
194 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
27923979 |
tttgatgacttatg-tgaacctccaaccgaattagaccgtacaagcatttctagatgtaaagtcactaaaaattgtgtatgtatcaatatgttttctcat |
27923881 |
T |
|
| Q |
195 |
at |
196 |
Q |
| |
|
|| |
|
|
| T |
27923880 |
at |
27923879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 16713969 - 16713920
Alignment:
| Q |
21 |
aactgtgatagcctccgcctctattacgtgtagtctaggagtggatccac |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16713969 |
aactgtgatagcctccgcctctattacgtgtagtctaggagtggatccac |
16713920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University