View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_low_67 (Length: 248)
Name: NF17408_low_67
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_low_67 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 19 - 236
Target Start/End: Complemental strand, 12945719 - 12945502
Alignment:
| Q |
19 |
aaaacctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggtttcatcctct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12945719 |
aaaacctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggtttcatcctct |
12945620 |
T |
|
| Q |
119 |
accacccttcctcgctcattttccaccatccctgctctacattagctgctcaaattcctgccattgttgcctcggttgattatcgtctctcgcctgagca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12945619 |
accacccttcctcgctcattttccaccacccctgctctacattagctgctcaaattcctgccattgttgcctccgttgattatcgtctctcgcctgagca |
12945520 |
T |
|
| Q |
219 |
tcgcctcccagcagccta |
236 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12945519 |
tcgcctcccagcagccta |
12945502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 12938049 - 12937938
Alignment:
| Q |
17 |
caaaaacctccattcgtctcttcctcccgaaccctccaccgtcttcctctgctgccaaactccccattattctctacttccatggtggtggtttcatcct |
116 |
Q |
| |
|
|||| |||||||| || |||||||||| ||||||||||| |||| || || || || ||||| | ||||||||||||||||||||||||||| ||| |
|
|
| T |
12938049 |
caaacacctccatccgcatcttcctcccaaaccctccaccaccttcttccgcggctaagctccctctcattctctacttccatggtggtggtttcttccg |
12937950 |
T |
|
| Q |
117 |
ctaccacccttc |
128 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
12937949 |
ctaccatccttc |
12937938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University