View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_low_71 (Length: 244)
Name: NF17408_low_71
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_low_71 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 7894308 - 7894535
Alignment:
| Q |
1 |
cgaccaaatcgcatcctcggcgttcgcagcaactcaatcagaatcactccgtactccatttctcactctcaggtacttcatttctccattctttg-agtg |
99 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7894308 |
cgaccaaatcgccacctcggcgttcgcagcaactcagtcagaatcactccttactccatttctcactctcaggtacttcatttctccattcttttcagtg |
7894407 |
T |
 |
| Q |
100 |
ttgttgtttttcgttttgatcaaaatgagtgattgaattgattcatgaaaatgcagatgcttgaaagagaagcgttgcgaagaagcaatgttgatgatat |
199 |
Q |
| |
|
|| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7894408 |
tttttgtttttggttttgatcaaaatgagtgattgaattgattcatgaaaatgcagatgcttgaaagagaagcgttgcgaagaagcaatgttgatgatgt |
7894507 |
T |
 |
| Q |
200 |
tcctcaagaaatggttctggatcaacct |
227 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
7894508 |
tcctcaagaaatggttctggatcaacct |
7894535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University