View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17408_low_77 (Length: 238)
Name: NF17408_low_77
Description: NF17408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17408_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 5699858 - 5699637
Alignment:
| Q |
1 |
ctcatggcacacgtgtgttatagtcaaaatacatgatcaccaatcatcacaatgatgcacctgcaatggaagtgtgaatattattccacttacacttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5699858 |
ctcatggcacacgtgtgttatagtcaaaatacatgatcaccaatcatcacaatgatgcacctgcaatggaagtgtgaatattattccacttacacttcac |
5699759 |
T |
|
| Q |
101 |
agtatatttatgannnnnnngacggataaataaactatggttatgattgtgaatgccgttgtgcaactttgcttgccactttgcaaaccaactcaggtat |
200 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5699758 |
agtatatttatgatttttttgacggatagataaactatggttatgattgtgaatgccgttgtgctactttgcttgccactttgcaaaccaactcaggtat |
5699659 |
T |
|
| Q |
201 |
gtcactgcccaaacataaactt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5699658 |
gtcactgcccaaacataaactt |
5699637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University