View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_104 (Length: 292)
Name: NF1740_high_104
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_104 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 16 - 292
Target Start/End: Original strand, 32670703 - 32670979
Alignment:
| Q |
16 |
gatatggattcttctacatatttgaaattatgtatcattgatgcaaagcttgttatgtcaatgtcgtgaacaaagggacgaaatacacgtagttatcaag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32670703 |
gatatggattcttctacatatttgaaattatgtatcattgatgcaaagcttgttatgtcaatgtcgtgaacaaagggacgaaatacatgtagttatcaag |
32670802 |
T |
|
| Q |
116 |
agtaaataaatattcctttaatcatttcttaatgcaactatgggagaaaatgttgtggttatatgtgagtaactatagggaggcctttattgcatggaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32670803 |
agtaaataaatattcctttaatcatttcttaatgcaactatgggagaaaatgttgtggttatatgtgagtaactatagggaggcctttattgcatggaaa |
32670902 |
T |
|
| Q |
216 |
gttgttagagaaccttaaatcatattcatagagaataaggaacccctttattccgctcaacttcttctcactcgacc |
292 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||| |
|
|
| T |
32670903 |
gttgttagagaagcttaaatcatattcatagagaataaggaacccctttattccgctcaactttttttctctcgacc |
32670979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University