View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_112 (Length: 281)
Name: NF1740_high_112
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_112 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 12 - 266
Target Start/End: Original strand, 1802403 - 1802657
Alignment:
| Q |
12 |
tactaatttggagcattctcaaatactacctttctctttggtctaatagtgttttcaacatggtacaggagaagttgaatagatctatgatggtttgtca |
111 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1802403 |
tactaatttgaagcattctcaaatactaccttcctctttggtctaatagtgttttcaacatggtacaggagaagttgaatagatctatgatggtttgtca |
1802502 |
T |
 |
| Q |
112 |
agacaagtatgagggatccaagctccaacagaaacctggagctatgaatgatatgatttcctgtgctgatgaagcgattcaagacagcattaagatgctg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1802503 |
agacaagtatgagggatccaagctccaacagaaacctggagctatgaatgatatgatttcctgtgctgatgaagcgattcaagacagcattaagatgctg |
1802602 |
T |
 |
| Q |
212 |
ccgcttcttacaaacaaattgaaggcttcctttggcattcctgacaagagttctt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1802603 |
ccgcttcttacaaacaaattgaaggcttcctttggcattcctgacaagagttctt |
1802657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University