View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_120 (Length: 271)
Name: NF1740_high_120
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_120 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 59 - 256
Target Start/End: Original strand, 31699440 - 31699636
Alignment:
| Q |
59 |
gaaggaatattttta-gtcttattttgttaatcactattcgaggaatccagaattttcgaacgatacacgtgtcagagatatcacagcccacactatgat |
157 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
31699440 |
gaagaaatatttttaagtcttattttgttaatcactatccgaggaatccagaaatttcgaaccatacacgtgtcagagatagcacagcccacact--gat |
31699537 |
T |
|
| Q |
158 |
gtaccagcgaagttacgtctttgtttccccactcgcgtaaagtatgtctcgcgaagtttcttttaacttgttttaattaattcaacctgcagtaataat |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699538 |
gtaccagcgaagttacgtctttgtttccccactcgcgtaaagcatgtctcgcgaagtttcttttaacttgttttaattaattcaacctgcagtaataat |
31699636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University