View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_123 (Length: 262)
Name: NF1740_high_123
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_123 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 68 - 215
Target Start/End: Complemental strand, 47350751 - 47350604
Alignment:
| Q |
68 |
agctgagaatgaaaggcattttcattggagctgggattcatgagctacgcttagctgaagttagtatgatggctcttgaagaaaccactctcttccaaca |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350751 |
agctgagaatgaaaggcattttcattggagctgggattcatgagctacgcttagctgaagttagtatgatggctcttgaagaaaccactctcttccaaca |
47350652 |
T |
 |
| Q |
168 |
ttgttttagttgaaggtcacagtttgttcattttttaacgtcccatta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47350651 |
ttgttttagttgaaggtcacagtttgttcattttttaacgtcccatta |
47350604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University