View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_143 (Length: 249)
Name: NF1740_high_143
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_143 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 19074328 - 19074561
Alignment:
| Q |
1 |
cagttgataaagaaaagggtgtcacacttgaggattttaagctcattaagatgcatatgtccaattgtatgtatgctcactttttatatatctatatgca |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19074328 |
cagttgataaagaaaagggtgtcacccttgaggattttaagctcattaagatgcatatgtccaattgtatgtatgctcactttttatatatctatatgca |
19074427 |
T |
 |
| Q |
101 |
tatcttcaatttcgatgtttggatagagggttttggagggtgaaatttatatatttgaattaagcgatttcannnnnnnnnnnnnnnnnnnnattagtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19074428 |
tatcttcaatttcgatgtttggatagagggttttggagggtgaaatttatatatttgaattaagcgatttcattttttattttactttttttattagtgt |
19074527 |
T |
 |
| Q |
201 |
agtaagtagtaatgctcgtgtaaaattgtgtact |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19074528 |
agtaagtagtaatgctcgtgtaaaattgtgtact |
19074561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University