View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_150 (Length: 237)
Name: NF1740_high_150
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_150 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 221
Target Start/End: Complemental strand, 42955020 - 42954810
Alignment:
| Q |
13 |
attctaggttaacaatgtcaaacatggtaataaataattacaatactattttgatcaataattgcttataacttggagttaggannnnnnnnn--gaaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
42955020 |
attctaggttaacaatgtcaaacatggtaataaataattacaatactattttgatcaatatttgcttataacttggagttaggatttttttttttgaaag |
42954921 |
T |
|
| Q |
111 |
acttggagttaggattgtgaagatgatattgctcctttattattgatctttcacttatccgaagctcgatcataccatgatcgaaaatatcgttataata |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42954920 |
acttggagttaggattgtgaagatgatattgctcctttattattgatctttcacttatccgaagctcgatcatacgatgatcgaaaatatcgttataata |
42954821 |
T |
|
| Q |
211 |
cataacctttt |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
42954820 |
cataacctttt |
42954810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University