View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_169 (Length: 215)
Name: NF1740_high_169
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_169 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 43396962 - 43397146
Alignment:
| Q |
18 |
aaaggggtggtgaaaatccaccttgggtgttgtggaaagctagaaatggtaaaatttttaatgaaaccaattttgaggtggatgagctagtggaggaaat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396962 |
aaaggggtggtgaaaatccaccttgggtgttgtggaaagctagaaatggtaaattttttaatgaaaccaattttgaggtggatgagctagtggaggaaat |
43397061 |
T |
 |
| Q |
118 |
caaggttatgtcttggcggtggttgttgcatcatacgaagattccggtttgcctttactacgaatggtgttggaatccctatgct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43397062 |
caaggttatgtcttggcggtggttgttgcatggtacgaagattccggtttgcctttactacgaatggtgttggaatccctatgct |
43397146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 97 - 145
Target Start/End: Complemental strand, 3499446 - 3499398
Alignment:
| Q |
97 |
ggatgagctagtggaggaaatcaaggttatgtcttggcggtggttgttg |
145 |
Q |
| |
|
||||||||||||| |||| |||||||| ||||||||| ||| ||||||| |
|
|
| T |
3499446 |
ggatgagctagtgaaggagatcaaggtgatgtcttggaggtcgttgttg |
3499398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 83
Target Start/End: Original strand, 40086943 - 40086986
Alignment:
| Q |
40 |
ttgggtgttgtggaaagctagaaatggtaaaatttttaatgaaa |
83 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
40086943 |
ttgggtattgtggaaagctaggaatgataaaatttttaatgaaa |
40086986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 164 - 192
Target Start/End: Original strand, 6495524 - 6495552
Alignment:
| Q |
164 |
gtttgcctttactacgaatggtgttggaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6495524 |
gtttgcctttactacgaatggtgttggaa |
6495552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University