View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_174 (Length: 206)
Name: NF1740_high_174
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_174 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 36771174 - 36770998
Alignment:
| Q |
17 |
catatactataatacagtattctctattattattatattcacaaccataggaaaattttgtgctcacttgatctttttaactaatcactgaccaatgacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36771174 |
catatactataatacagtattctctattattat---attcacaaccataggaaaattttgtgctcacttgatcttattaactaatcactgaccaatgacc |
36771078 |
T |
|
| Q |
117 |
atgtatttagtataataaacgtcattgtcaacaattgaattatttcactttttaggattccagcaaaccctatgcttctc |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36771077 |
atgtatttagtataataaacatcattgtcaacaattgaattatttcactttttaggattccagcaaaccctatgtttctc |
36770998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 112 - 167
Target Start/End: Complemental strand, 36783619 - 36783564
Alignment:
| Q |
112 |
tgaccatgtatttagtataataaacgtcattgtcaacaattgaattatttcacttt |
167 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
36783619 |
tgaccatgtatttagcataataaacatcattgtcaacaattgaatcatttaacttt |
36783564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University