View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_57 (Length: 388)
Name: NF1740_high_57
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 17 - 342
Target Start/End: Complemental strand, 46726326 - 46726001
Alignment:
| Q |
17 |
atcaataagaatctgtgnnnnnnngaaataaagttagagagagaaagatgaaatggtgaatgtgggttagggtttacagttacagacttctttgtaaaca |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46726326 |
atcaataagaatctgtgaaaaaaagaaataaagttagagagagaaagatgaaatggtgaatgtgggttagggtttacagttacagacttctttgtaaaca |
46726227 |
T |
 |
| Q |
117 |
ggagcaggcatattggcgacacggccggatcttcgaacaacaacgagctctttcttgataggagtgcgaggtttggaaggtgagggttttgaaatggggg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46726226 |
ggagcaggcatattggcgacacggccggatcttcgaacaacaacgagctctttcttgataggagtgcgaggtttggaaggtgagggttttgaaatggggg |
46726127 |
T |
 |
| Q |
217 |
aagatgatttgtgaagagattgagagagcttggtaagattcagagcttccattctcttttgattctcttccattctcttgcggcgactctcttcgtatga |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46726126 |
aagatgatttgtgaagagattgagagagcttggtaagactcagagcttccattctcttttgattctcttccattctcttgcggcgactctcttcgtatga |
46726027 |
T |
 |
| Q |
317 |
tgatgcttttgccaccattttgattt |
342 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46726026 |
tgatgcttttgccaccattttgattt |
46726001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University