View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_66 (Length: 368)
Name: NF1740_high_66
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_66 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 358
Target Start/End: Complemental strand, 35961612 - 35961268
Alignment:
| Q |
18 |
aaaagttccactttgtttactgttagattgtgttagcttggatcagctgtaattgaatctgttttagtttagtcactg--caattctttgttgacaagtt |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35961612 |
aaaagttccattttgtttactgttagattgtgttagcttggatcagctgtaattgaatctgttttagtttagtcactgtgcaattctttgttgacaagtt |
35961513 |
T |
|
| Q |
116 |
tcggaagtttcatttagtttacgttgcaattgctttagcttatagcttagttgtgattgaattttttctagtttagattactgtacaattgtccgttcct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35961512 |
tcggaagtttcatttagtttacgttgcaattgctttagcttatagcttagttgtgattgaattttttctagtttagattactgtacaattgtccgttcct |
35961413 |
T |
|
| Q |
216 |
cttataatgttcttttgtaactagtggcagactacatatttgtacttgtattgtacccaaatggaaaaagctacatggaatgataacatttgatttgttt |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
35961412 |
cttataatgttcttttgtaactagtggcagactacatatttgtacttgtattgtacccaaatggaaaaaactacatggaataataacatttgatttgttt |
35961313 |
T |
|
| Q |
316 |
cttctctttactttcttacagtt--tgagtttcatttattttctt |
358 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35961312 |
cttctctttactttcttacagtttctgagtttcatttattttctt |
35961268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University