View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_77 (Length: 343)
Name: NF1740_high_77
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_77 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 5e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 139 - 269
Target Start/End: Original strand, 288089 - 288219
Alignment:
| Q |
139 |
gaaaaattaaatcatcgaatatcttttttctaaatggttgtgttcatataaaaattaaatatcacacgaatgatattcagaagaaaaggaacatataatg |
238 |
Q |
| |
|
||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
288089 |
gaaaaattagatcattgaatagcttttttctaaatggttgtgttcatataaaaataaaatatcacacgcatgatattcagaagaaaaggaacatataatg |
288188 |
T |
|
| Q |
239 |
aagattcagaatattagcaacagtaaaaagg |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
288189 |
aagattcagaatattagcaacagtaaaaagg |
288219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 53
Target Start/End: Original strand, 287915 - 287951
Alignment:
| Q |
17 |
tttagtttcattgtaaactgccatatttaatctatat |
53 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
287915 |
tttagtttcattgaaaactgccgtatttaatctatat |
287951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University