View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_high_80 (Length: 342)
Name: NF1740_high_80
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_high_80 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 59 - 199
Target Start/End: Complemental strand, 27474456 - 27474316
Alignment:
| Q |
59 |
cattgcttgacgcgaagatgaaggagatggaagagaaaagcgagattcagaagaatctcgaaattcaagtcgatcgattgttccgtttgaaggaactcaa |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27474456 |
cattgcttgacgcgaagatgaaggagatggaagagaaaagcgagattcagaagaatctcgaaattcaagtcgatcgattgttccgtttgaaggaactcaa |
27474357 |
T |
|
| Q |
159 |
atatcgatgcatggtgcgcaacagtttaactaacatctcag |
199 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27474356 |
atatcgatgcatggtgcgcaaaagtttaactaacatctcag |
27474316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 251 - 323
Target Start/End: Complemental strand, 27474264 - 27474192
Alignment:
| Q |
251 |
gattgtaacagagagtttctccaattcgaacgcttagagagaaagaacatgaaaagattatcaacgaagccac |
323 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27474264 |
gattgtaacagagagtttctccgattcgaacgcttagagagaaagaacatgaaaagattatcaacgaagccac |
27474192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 264 - 310
Target Start/End: Original strand, 1178686 - 1178732
Alignment:
| Q |
264 |
agtttctccaattcgaacgcttagagagaaagaacatgaaaagatta |
310 |
Q |
| |
|
||||||||| |||||||| |||||||| || |||||||||||||||| |
|
|
| T |
1178686 |
agtttctccgattcgaacacttagagaaaacgaacatgaaaagatta |
1178732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University