View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_106 (Length: 297)
Name: NF1740_low_106
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_106 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 190 - 293
Target Start/End: Original strand, 32267170 - 32267273
Alignment:
| Q |
190 |
ttatttctttcttctgtcatgtgtgttctgatgtgaccaccaagagacttcccacaaggaaacctcttgaagcaatatttgcatacaaacttcctatgct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32267170 |
ttatttctttcttctgtcatgtgtgttctgatgtgaccaccaagagacttcccacaaggaaacctcttgaagcaatatttgcatacaaacttcctatgtt |
32267269 |
T |
|
| Q |
290 |
tctc |
293 |
Q |
| |
|
|||| |
|
|
| T |
32267270 |
tctc |
32267273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 37 - 117
Target Start/End: Original strand, 32267020 - 32267100
Alignment:
| Q |
37 |
tgatgattataatgatgatgatgagaatgcacaaacctcattgttttcttgggattttctcttagaccataaatgaggttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267020 |
tgatgattataatgatgatgatgagaatgcacaaacctcattgttttcttgggattttctcttagaccataaatgaggttt |
32267100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 64 - 116
Target Start/End: Original strand, 19301508 - 19301560
Alignment:
| Q |
64 |
tgcacaaacctcattgttttcttgggattttctcttagaccataaatgaggtt |
116 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
19301508 |
tgcacaaacctagttgttttcttgggattctctctaagaccataaataaggtt |
19301560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University