View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_107 (Length: 296)
Name: NF1740_low_107
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_107 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 57 - 184
Target Start/End: Original strand, 28120243 - 28120371
Alignment:
| Q |
57 |
tcttaaacaaacacaccataaagtgtttggttcacg--atggatttaaattttaaattttgtgaacccagtatgttgaaagaaaattgtgaaccttttat |
154 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28120243 |
tcttaaacaaacacaccataaagtgattggttcaggtaatggatttaaagtttaaattttgtgaacccagtatgttgaaagaaaattgtgaa-cttttat |
28120341 |
T |
|
| Q |
155 |
ttggttgttggataagtgcttatcatccat |
184 |
Q |
| |
|
||||||||||||||||||||| |||||||| |
|
|
| T |
28120342 |
ttggttgttggataagtgcttctcatccat |
28120371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 247 - 291
Target Start/End: Original strand, 28120434 - 28120478
Alignment:
| Q |
247 |
gttaatatattgtaagattattatgtgttgatccagaattattta |
291 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
28120434 |
gttaatatagcgtaagattattatgtgttgatccagacttattta |
28120478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University