View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_119 (Length: 279)
Name: NF1740_low_119
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_119 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 24757633 - 24757382
Alignment:
| Q |
18 |
cagatctcaatctgtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttcca |
117 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24757633 |
cagatctagatctgtttgtgatgacaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttcca |
24757534 |
T |
|
| Q |
118 |
cgaacttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgnnnnnnngctggaatgagaaagagctag |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24757533 |
cgatcttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgtttttttgctggaatgagaaagagctag |
24757434 |
T |
|
| Q |
218 |
ttaaacctagatatttcgttttgtgttgcctttataagttctaattcctttg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24757433 |
ttaaacctagatatttcgttttgtgttgcctttataagttctaattactttg |
24757382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 269
Target Start/End: Complemental strand, 24766630 - 24766379
Alignment:
| Q |
18 |
cagatctcaatctgtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttcca |
117 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24766630 |
cagatctagatctgtttgtgatgacaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttcca |
24766531 |
T |
|
| Q |
118 |
cgaacttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgnnnnnnngctggaatgagaaagagctag |
217 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24766530 |
cgatcttgggctctttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggccgtttttttgctggaatgagaaagagctag |
24766431 |
T |
|
| Q |
218 |
ttaaacctagatatttcgttttgtgttgcctttataagttctaattcctttg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24766430 |
ttaaacctagatatttcgttttgtgttgcctttataagttctaattactttg |
24766379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 31 - 187
Target Start/End: Original strand, 24995799 - 24995955
Alignment:
| Q |
31 |
gtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctc |
130 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||| |||| |||||| |||| || |||||| |||||| ||||||||| ||||||||| |
|
|
| T |
24995799 |
gtttgtgatgtcgaatgatccatttaagcacatgtggtatgcacgtggagtggatggtgctcctggcccagattcaaatgccttccacgatcttgggctc |
24995898 |
T |
|
| Q |
131 |
tttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctaggc |
187 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||| | | |||||||||||||||| |
|
|
| T |
24995899 |
tttggtgatggatttgatgtcgtttttgaaattgccctgcgaaactataacctaggc |
24995955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 31 - 185
Target Start/End: Original strand, 23682754 - 23682908
Alignment:
| Q |
31 |
gtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctc |
130 |
Q |
| |
|
||||| |||||| ||||||| |||||||||||||||||||||| ||||| |||||| ||| |||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
23682754 |
gtttgagatggcgaatgatcattttaagcacatgtggtatgcacgtggattggatggtgctcttggaccagatccaaatgtcttccgcgaccttgggctc |
23682853 |
T |
|
| Q |
131 |
tttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctag |
185 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| || |||||| ||||||| |
|
|
| T |
23682854 |
attggtgatggatttgatgctgtttttgcagttgccctagcaaactacaacctag |
23682908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 31 - 185
Target Start/End: Original strand, 24054991 - 24055145
Alignment:
| Q |
31 |
gtttgtgatggcaaatgatccatttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctc |
130 |
Q |
| |
|
||||| |||||| ||||||| |||||||||||||||||||||| ||||| |||||| ||| |||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
24054991 |
gtttgagatggcgaatgatcattttaagcacatgtggtatgcacgtggattggatggtgctcttggaccagatccaaatgtcttccgcgaccttgggctc |
24055090 |
T |
|
| Q |
131 |
tttggtgatggatttgatgccgtttttgcaattgccgtacaaaactataacctag |
185 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| || |||||| ||||||| |
|
|
| T |
24055091 |
attggtgatggatttgatgctgtttttgcagttgccctagcaaactacaacctag |
24055145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 52 - 165
Target Start/End: Original strand, 23681586 - 23681699
Alignment:
| Q |
52 |
atttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctctttggtgatggatttgatgcc |
151 |
Q |
| |
|
||||||| ||||||||| ||||| ||||| | |||| |||| ||||||||| || ||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
23681586 |
atttaagaacatgtggtttgcacttggattgaatggtgctcctggaccagattcagatgtcttccacgactttgggctaattggtgatggatttgatgcg |
23681685 |
T |
|
| Q |
152 |
gtttttgcaattgc |
165 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
23681686 |
gtttttgcagttgc |
23681699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 52 - 165
Target Start/End: Original strand, 24053823 - 24053936
Alignment:
| Q |
52 |
atttaagcacatgtggtatgcacatggatcggatggatctcccggaccagatccaaatgtcttccacgaacttgggctctttggtgatggatttgatgcc |
151 |
Q |
| |
|
||||||| ||||||||| ||||| ||||| | |||| |||| ||||||||| || ||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
24053823 |
atttaagaacatgtggtttgcacttggattgaatggtgctcctggaccagattcagatgtcttccacgactttgggctaattggtgatggatttgatgcg |
24053922 |
T |
|
| Q |
152 |
gtttttgcaattgc |
165 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
24053923 |
gtttttgcagttgc |
24053936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University