View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_121 (Length: 274)
Name: NF1740_low_121
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_121 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 70 - 266
Target Start/End: Original strand, 30528805 - 30529001
Alignment:
| Q |
70 |
gtgttattaggtgggtccataatgctatatacatatggttgcaaatttgctgtgtttagttgcaaaatttaatttagtcaataatgaaccgttatgagat |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30528805 |
gtgttattaggtgggtccataatgctatatacatatggttgcaaatttgctgtgtttagttgcaaaatttaatttagtcaataatgaaccgttatgagat |
30528904 |
T |
 |
| Q |
170 |
actagtattgaatgaagactgcatttggattggattagggtttaatgatttaacactaaagcacaaagttgatgtgtaatgattttgtttctctgct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30528905 |
actagtattgaatgaagactgcatttggattggattagggtttaatgatttaacactaaagcataaagttgatgtgtaatgattttgtttctctgct |
30529001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 17 - 48
Target Start/End: Original strand, 30528752 - 30528783
Alignment:
| Q |
17 |
acaagagggcaattctttttagaagaaattac |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30528752 |
acaagagggcaattctttttagaagaaattac |
30528783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University