View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_122 (Length: 273)
Name: NF1740_low_122
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_122 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 52 - 262
Target Start/End: Original strand, 7801738 - 7801948
Alignment:
| Q |
52 |
aactaggtcaattggtagtagaggaaacctaagtagttgttagtttcaattcaattagtgatattttggagtttgatatgcttttcagtttttcaattca |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801738 |
aactaggtcaattggtagtagaggaaacctaagtagttgttagtttcaattcaattagtgatattttggagtttgatatgcttttcagtttttcaattca |
7801837 |
T |
|
| Q |
152 |
ctcaatctcaattttcgttgtgttatgttggtgctcaatctgttttgttgtgttggcgttaaatcttttcattctcagtaatgttgtctttgtgctggtg |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7801838 |
ctcaatctcaattttcgttgtgttatgttggtgctcaatctgttttgttgtgttggcgttaaatcttttcattctcagtaatgttgtctttgtgctggtg |
7801937 |
T |
|
| Q |
252 |
ttcatctcact |
262 |
Q |
| |
|
||||||||||| |
|
|
| T |
7801938 |
ttcatctcact |
7801948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University