View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_137 (Length: 253)
Name: NF1740_low_137
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_137 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 30684003 - 30684227
Alignment:
| Q |
13 |
aaaatcacttcgtttcaagttgacgccaaaactgggtcggtcagtacaaatagtaagaattttgctgctcttcgaaatttaaatgcatcaaagccactgc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
30684003 |
aaaatcacttcgtttcaagttgacgccaaaactgggtcggtcagtacaaatagtaagaattttgctggtcttcgaaatttaaatgcatcaaagccgctgc |
30684102 |
T |
|
| Q |
113 |
tgatcaatatttataggaaagatctttttctgaagtatgatggtccctcgtcgggatcaggattttggaatttgacagtagccgagtttgatgcagtgtt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30684103 |
tgatcaatatttataggaaagatctttttctgaagtatgatggtcccacgtcgggatcaggattttggaatttgacagtagccgagttcgatgcagtgtt |
30684202 |
T |
|
| Q |
213 |
attatgccaacatataactacattt |
237 |
Q |
| |
|
||||||||||||| ||||||||||| |
|
|
| T |
30684203 |
attatgccaacatttaactacattt |
30684227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University