View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_142 (Length: 250)
Name: NF1740_low_142
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_142 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 38521675 - 38521563
Alignment:
| Q |
1 |
ttgtagctcttgatttttggtaattttgttctgattatgttcccatgatttgttttgattatgtttttgtgtcccctttagtaatttcatgttgttcctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38521675 |
ttgtagctcttgatttttggtaattttgttctgattatgttcccatgatttgttttgattatgtttttgtgtcccctttagtaatttcatgttgttcctg |
38521576 |
T |
|
| Q |
101 |
ccgacacatatta |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38521575 |
ccgacacatatta |
38521563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 182 - 243
Target Start/End: Complemental strand, 38521494 - 38521433
Alignment:
| Q |
182 |
attccctactcagtttgtgcactcttttcctaaaattatgcatgactgagtgtgatgatgtc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38521494 |
attccctactcagtttgtgcactcttttcctaaaattatgcatgactgagtgtgatgatgtc |
38521433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University