View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_144 (Length: 249)
Name: NF1740_low_144
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_144 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 52145596 - 52145364
Alignment:
| Q |
1 |
taaacccaagagctcaaagcttttcaactgaaatctcaggcttccttacccagaatgaagacgttgatgacgaagatgaaggaactaagttatacatgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52145596 |
taaacccaagagctcaaagcttttcaactgaaatctcaggcttccttacccagaatgaagacgttgatgacgaagatgaaggaactaagttatacatgtg |
52145497 |
T |
|
| Q |
101 |
tccaaataagtgtaaatttgaggtaacaaatgataacacaactcgttgtactgccctgtctgccaatgaccattctcatatttttgggtctagtccagta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52145496 |
tccaaataagtgtaaatttgaggtaacaaatgataacacaactcgttgtactgccctgtctgccaatgaccattctcatatttttgggtctagtccagta |
52145397 |
T |
|
| Q |
201 |
tactgcccgaacactatgagcagtgaagtttct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52145396 |
tactgcccgaacactatgagcagtgaagtttct |
52145364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 52142078 - 52142021
Alignment:
| Q |
1 |
taaacccaagagctcaaagcttttcaactgaaatctcaggcttccttacccagaatga |
58 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
52142078 |
taaacccaagagctcaaagctcgtcaactgaaatttcaggattccttacccagaatga |
52142021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 17522509 - 17522563
Alignment:
| Q |
1 |
taaacccaagagctcaaagcttttcaactgaaatctcaggcttccttacccagaa |
55 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||| |||||||| ||||| |
|
|
| T |
17522509 |
taaacccaagagctcaaagctcgtcaactgaaatcgcaggattccttactcagaa |
17522563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University