View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_150 (Length: 246)
Name: NF1740_low_150
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_150 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 43107231 - 43106992
Alignment:
| Q |
1 |
atgaatcaaactagtatttttt-atgttattatattatatgtgtaacttcttgtgactagggttttttgtttcctattactnnnnnnnnctagaggtttt |
99 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43107231 |
atgaatcaaactagtatttttttatgttattatgttatatgtgtaacttcttgtgactagggttttttgtttcctattactaaaaaaaactagaggtttt |
43107132 |
T |
 |
| Q |
100 |
tccacctactttattctatttcaattgtgtgtgtttttcttctttcaaatatcaatgttagttgttatttttgtcatatggaggaatgaatatctgactt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43107131 |
tccacctactttattctatttcaattgtgtgcgtttttcttctttcaaatatcaatgttagttgttatttttgttatatggaggaatgaatatctgactt |
43107032 |
T |
 |
| Q |
200 |
catcattgtgtgtttgtgtggtgtattgataatgtctctg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43107031 |
tatcattgtgtgtttgtgtggtgtattgataatgtctctg |
43106992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University