View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_151 (Length: 243)
Name: NF1740_low_151
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_151 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 29642686 - 29642461
Alignment:
| Q |
1 |
taatcgcaggtgtttatgttgtatccgtatatgacaccgatatttgtcagagtttgaacacgcctacaatatgaagtgtcgatcatatgttttcagccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
29642686 |
taatcgcaggtgtttatgttgtatccgtatatgacaccgatatttgtcagagtttgaacacgcctacaatatgaagtgtcgatcatatgttttcagctat |
29642587 |
T |
|
| Q |
101 |
caactatttcatcataatcaactactaattttgtaatattaggataatattgatgatgttctcagtctggaaatatttcaaaaaataaatggaatttgnn |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29642586 |
caactatttcatcataatcaactactaattttgtaatattaggataatattgatgatggtctcagtctggaaatatttcaaaaaataaatggaatttgaa |
29642487 |
T |
|
| Q |
201 |
nnnnnntctaaaatttctagatttag |
226 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29642486 |
aaaaaatctaaaatttctagatttag |
29642461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University