View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_152 (Length: 241)
Name: NF1740_low_152
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_152 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 3854232 - 3854009
Alignment:
| Q |
1 |
acttatgctgaacacacacctatgttagccctcctctagtcaactcttgtacgtgttgctctttaatgaggcgaaatcacacaattgatttttctaatga |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854232 |
acttatgctgatcacacacctatgttagccctcctctagtcaactcttgtatgtgttgctctttaatgaggcgaaatcacacaattgatttttctaatga |
3854133 |
T |
 |
| Q |
101 |
tcaaatgatctcggttatcggttttataatcaaacttggctcctctatataaagagctcatctccctcaaatgatcaactagtgaannnnnnnattctct |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
3854132 |
tcaaatgatctcggttat-tgttttataaccaaacttggctcctctatataaagagctcatctccttcaaatgagcaactagtgaatttttttattctct |
3854034 |
T |
 |
| Q |
201 |
ctcttcagctcgatgcacttctgtc |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
3854033 |
ctcttcagctcgatgcacttctgtc |
3854009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University