View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1740_low_158 (Length: 235)
Name: NF1740_low_158
Description: NF1740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1740_low_158 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 5 - 75
Target Start/End: Complemental strand, 42308442 - 42308372
Alignment:
| Q |
5 |
gctatgaaattgaaaatctaaataaaagttagaagaagctaatagaagatatagaataaggatgatttggc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42308442 |
gctatgaaattgaaaatctaaataaaagttagaagaagctaatagaagatatagaataaggatgatttggc |
42308372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 141 - 220
Target Start/End: Complemental strand, 42308317 - 42308238
Alignment:
| Q |
141 |
gattacctagg-aattggatgaggaaacaaagtatagaaggtgaagaagaaaatgggtgagttaggagtgaatggaaaatg |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
42308317 |
gattacctagggaattggatgaggaaacaaagtatagaaggtgaagaagaaaatggatgagtta-gagtgaatggaaaatg |
42308238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University